shRNA Adeno-associated Virus Serotype 2, pH1-(SDHAF2-shRNA-Seq2)(CAT#: AAV-SI0979WQ)
This product is a SDHAF2-shRNA encoding AAV, which is based on AAV-2 serotype. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SDHAF2-shRNA-Seq2 |
| Related Target/Protein | SDHAF2 |
| Region | CDS |
| TargetSeq | CCTGCTCTATGAGAGCAGAAA |
| NCBI RefSeq | NM_017841 |
| Alternative Names | PGL2; SDH5; C11orf79 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Paraganglioma |