shRNA Adeno-associated Virus Serotype 2, pH1-(Tcte1-shRNA-Seq2)(CAT#: AAV-SI2748WQ)

This product is a Tcte1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tcte1-shRNA-Seq2
Related Target/Protein Tcte1
Region CDS
TargetSeq CTTCTCCTCACCCACTAACAA
NCBI RefSeq NM_013688
Alternative Names DRC5; D6S46; FAP155
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 202500
Uniprot ID Q5JU00

Related Products