shRNA Adeno-associated Virus Serotype 2, pH1-(TMEM205-shRNA-Seq2)(CAT#: AAV-SI0842WQ)
This product is a TMEM205-shRNA encoding AAV, which is based on AAV-2 serotype. Elevated expression of TMEM205, a hypothetical membrane protein, is associated with cisplatin resistance. The expression of TMEM205-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TMEM205-shRNA-Seq2 |
Related Target/Protein | TMEM205 |
Region | CDS |
TargetSeq | GATGGTCCATCTACTGGTCTT |
NCBI RefSeq | NM_198536 |
Alternative Names | UNQ501 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ovarian cancer |