shRNA Adeno-associated Virus Serotype 2, pH1-(TRABD-shRNA-Seq2)(CAT#: AAV-SI0750WQ)
This product is a TRABD-shRNA encoding AAV, which is based on AAV-2 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TRABD-shRNA-Seq2 |
Related Target/Protein | TRABD |
Region | 3UTR |
TargetSeq | CCACCCAAATAAAGGATTATT |
NCBI RefSeq | NM_025204 |
Alternative Names | LP6054; PP2447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Graves' Disease |