shRNA Adeno-associated Virus Serotype 2, pH1-(Trmt1-shRNA-Seq5)(CAT#: AAV-SI2857WQ)
This product is a Trmt1-shRNA encoding AAV, which is based on AAV-2 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Trmt1-shRNA-Seq5 |
| Related Target/Protein | Trmt1 |
| Region | CDS |
| TargetSeq | GTCTGAAAGCAGTCCAGCATT |
| NCBI RefSeq | NM_198020 |
| Alternative Names | TRM1; MRT68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive intellectual disorder (ARID) |