shRNA Adeno-associated Virus Serotype 2, pH1-(Ush1g-shRNA-Seq1)(CAT#: AAV-SI3129WQ)

This product is a Ush1g-shRNA encoding AAV, which is based on AAV-2 serotype. The Ush1g gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). The expression of Ush1g-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ush1g-shRNA-Seq1
Related Target/Protein Ush1g
Region 3UTR
TargetSeq GCTCTGAATTACAAGAGGATT
NCBI RefSeq NM_176847
Alternative Names SANS; ANKS4A
Titer >1*10^10 GC/mL
Related Diseases Usher syndrome type 1C
Target Gene
Gene ID 124590
Uniprot ID Q495M9

Related Products