shRNA Adeno-associated Virus Serotype 2, pH1-(VARS2-shRNA-Seq1)(CAT#: AAV-SI2383WQ)
This product is a VARS2-shRNA encoding AAV, which is based on AAV-2 serotype. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | VARS2-shRNA-Seq1 |
| Related Target/Protein | VARS2 |
| Region | CDS |
| TargetSeq | GACTCGCGATACACACATCTA |
| NCBI RefSeq | NM_020442 |
| Alternative Names | VALRS; VARSL; VARS2L; COXPD20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | oxidative phosphorylation deficiency-20 |