shRNA Adeno-associated Virus Serotype 2, pH1-(VRTN-shRNA-Seq2)(CAT#: AAV-SI0602WQ)
This product is a VRTN-shRNA encoding AAV, which is based on AAV-2 serotype. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | VRTN-shRNA-Seq2 |
| Related Target/Protein | VRTN |
| Region | CDS |
| TargetSeq | CCAAGTTGTACCTGGAGCATT |
| NCBI RefSeq | NM_018228 |
| Alternative Names | vertnin; C14orf115 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Development of Thoracic Vertebrae in Mammals |