shRNA Adeno-associated Virus Serotype 2, pH1-(ZDHHC15-shRNA-Seq1)(CAT#: AAV-SI2995WQ)
This product is a ZDHHC15-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by ZDHHC15 gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). The expression of ZDHHC15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZDHHC15-shRNA-Seq1 |
| Related Target/Protein | ZDHHC15 |
| Region | 3UTR |
| TargetSeq | CCATCAAATACTTGCTGTGTA |
| NCBI RefSeq | NM_144969 |
| Alternative Names | MRX91; DHHC15 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mental retardatio X-linked type 91 (MRX91) |
