shRNA Adeno-associated Virus Serotype 2, pU6-(2700050L05Rik-shRNA-Seq1)(CAT#: AAV-SI2242WQ)
This product is a 2700050L05Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The 2700050L05Rik gene has the ability to positive regulation of transcription. The expression of 2700050L05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 2700050L05Rik-shRNA-Seq1 |
| Related Target/Protein | 2700050L05Rik |
| Region | 3UTR |
| TargetSeq | CGGTGCTGAGACTTATTAAAT |
| NCBI RefSeq | NM_178115 |
| Alternative Names | AU022667; AW558805; Edrf1 |
| Titer | >1*10^10 GC/mL |
