shRNA Adeno-associated Virus Serotype 2, pU6-(2810403A07Rik-shRNA-Seq1)(CAT#: AAV-SI2339WQ)
This product is a 2810403A07Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2810403A07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 2810403A07Rik-shRNA-Seq1 |
| Related Target/Protein | 2810403A07Rik |
| Region | 3UTR |
| TargetSeq | GCATTCTTTCTTTACTGGGAT |
| NCBI RefSeq | NM_028814 |
| Alternative Names | Blom7; AI256352; AI451678; Kiaa0907; Khdc4; A430106P18Rik |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 74200 |
| Uniprot ID | A0A0G2JEG2 |
