shRNA Adeno-associated Virus Serotype 2, pU6-(4930447C04Rik-shRNA-Seq3)(CAT#: AAV-SI1864WQ)
This product is a 4930447C04Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | 4930447C04Rik-shRNA-Seq3 |
Related Target/Protein | 4930447C04Rik |
Region | CDS |
TargetSeq | GGACATTATACGTAGTTAATT |
NCBI RefSeq | NM_029444 |
Alternative Names | Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik |
Titer | >1*10^10 GC/mL |