shRNA Adeno-associated Virus Serotype 2, pU6-(BEST1-shRNA-Seq2)(CAT#: AAV-SI0236WQ)
This product is a BEST1-shRNA encoding AAV, which is based on AAV-2 serotype. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | BEST1-shRNA-Seq2 |
Related Target/Protein | BEST1 |
Region | 3UTR |
TargetSeq | GCCTGAATCAAATGGTTAGCT |
NCBI RefSeq | NM_004183 |
Alternative Names | ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Macular Dystrophy |