shRNA Adeno-associated Virus Serotype 2, pU6-(C17orf77-shRNA-Seq1)(CAT#: AAV-SI0202WQ)
This product is a C17orf77-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C17orf77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C17orf77-shRNA-Seq1 |
| Related Target/Protein | C17orf77 |
| Region | CDS |
| TargetSeq | CATCTGTAGCTACTTCTCTTT |
| NCBI RefSeq | NM_152460 |
| Titer | >1*10^10 GC/mL |
