shRNA Adeno-associated Virus Serotype 2, pU6-(C21orf93-shRNA-Seq1)(CAT#: AAV-SI0253WQ)
This product is a C21orf93-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C21orf93-shRNA-Seq1 |
| Related Target/Protein | C21orf93 |
| Region | 3UTR |
| TargetSeq | GAAACTGAACATCTCCAAGTA |
| NCBI RefSeq | NM_145179 |
| Alternative Names | NCRNA00315; LINC00315 |
| Titer | >1*10^10 GC/mL |
