shRNA Adeno-associated Virus Serotype 2, pU6-(C22orf39-shRNA-Seq3)(CAT#: AAV-SI0409WQ)
This product is a C22orf39-shRNA encoding AAV, which is based on AAV-2 serotype. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C22orf39-shRNA-Seq3 |
| Related Target/Protein | C22orf39 |
| Region | 3UTR |
| TargetSeq | CAGAACACACAACCTTGCATA |
| NCBI RefSeq | NM_173793 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Liver cancer |