shRNA Adeno-associated Virus Serotype 2, pU6-(C4orf41-shRNA-Seq1)(CAT#: AAV-SI0241WQ)

This product is a C4orf41-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C4orf41-shRNA-Seq1
Related Target/Protein C4orf41
Region CDS
TargetSeq GCTGCCATCTCTCAACATCAA
NCBI RefSeq NM_021942
Alternative Names GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18
Titer >1*10^10 GC/mL
Target Gene
Gene ID 60684
Uniprot ID Q7Z392

Related Products