shRNA Adeno-associated Virus Serotype 2, pU6-(C6orf141-shRNA-Seq1)(CAT#: AAV-SI0308WQ)

This product is a C6orf141-shRNA encoding AAV, which is based on AAV-2 serotype. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C6orf141-shRNA-Seq1
Related Target/Protein C6orf141
Region CDS
TargetSeq CCCAACTACCCTTCTGTCTTT
NCBI RefSeq NM_153344
Titer >1*10^10 GC/mL
Related Diseases Oral Cancer
Target Gene
Gene ID 135398
Uniprot ID Q5SZD1

Related Products