shRNA Adeno-associated Virus Serotype 2, pU6-(CCDC67-shRNA-Seq2)(CAT#: AAV-SI0195WQ)
This product is a CCDC67-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CCDC67-shRNA-Seq2 |
| Related Target/Protein | CCDC67 |
| Region | CDS |
| TargetSeq | GAACAAATTGACATCATGGTA |
| NCBI RefSeq | NM_181645 |
| Alternative Names | DEUP1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Papillary thyroid carcinoma, gastric cancer |
