shRNA Adeno-associated Virus Serotype 2, pU6-(CCDC80-shRNA-Seq2)(CAT#: AAV-SI0492WQ)
This product is a CCDC80-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CCDC80-shRNA-Seq2 |
| Related Target/Protein | CCDC80 |
| Region | CDS |
| TargetSeq | GAGTGTTAGAACTGTTCCCAA |
| NCBI RefSeq | NM_199511 |
| Alternative Names | CL2; URB; DRO1; SSG1; okuribin |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Metabolic disease |
