shRNA Adeno-associated Virus Serotype 2, pU6-(Cenpc1-shRNA-Seq2)(CAT#: AAV-SI1740WQ)
This product is a Cenpc1-shRNA encoding AAV, which is based on AAV-2 serotype. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Cenpc1-shRNA-Seq2 |
Related Target/Protein | Cenpc1 |
Region | CDS |
TargetSeq | CAGGTAATCATTACAACATTA |
NCBI RefSeq | NM_007683 |
Alternative Names | MIF2; hcp-4; CENP-C; CENPC |
Titer | >1*10^10 GC/mL |