shRNA Adeno-associated Virus Serotype 2, pU6-(Chchd7-shRNA-Seq1)(CAT#: AAV-SI2241WQ)

This product is a Chchd7-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Chchd7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Chchd7-shRNA-Seq1
Related Target/Protein Chchd7
Region CDS
TargetSeq CAGTTACTTCTTGAAGTACAA
NCBI RefSeq NM_181391
Alternative Names COX23
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79145
Uniprot ID Q9BUK0

Related Products