shRNA Adeno-associated Virus Serotype 2, pU6-(CLMP-shRNA-Seq2)(CAT#: AAV-SI0098WQ)
This product is a CLMP-shRNA encoding AAV, which is based on AAV-2 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CLMP-shRNA-Seq2 |
Related Target/Protein | CLMP |
Region | CDS |
TargetSeq | CAGAAGGAAGTGACCTGACTT |
NCBI RefSeq | NM_024769 |
Alternative Names | ACAM; ASAM; CSBM; CSBS |
Titer | >1*10^10 GC/mL |
Related Diseases | Congenital short bowel syndrome |