shRNA Adeno-associated Virus Serotype 2, pU6-(COG6-shRNA-Seq2)(CAT#: AAV-SI2290WQ)
This product is a COG6-shRNA encoding AAV, which is based on AAV-2 serotype. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | COG6-shRNA-Seq2 |
| Related Target/Protein | COG6 |
| Region | CDS |
| TargetSeq | GCAGGTTTAGAAATTATGGAA |
| NCBI RefSeq | NM_020751 |
| Alternative Names | COD2; SHNS; CDG2L |
| Titer | >1*10^10 GC/mL |