shRNA Adeno-associated Virus Serotype 2, pU6-(Csn1s1-shRNA-Seq1)(CAT#: AAV-SI2296WQ)
This product is a Csn1s1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Csn1s1 gene may play an important role in the capacity of milk to transport calcium phosphate. The expression of Csn1s1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Csn1s1-shRNA-Seq1 |
Related Target/Protein | Csn1s1 |
Region | CDS |
TargetSeq | CCCACAAATCTTCCAGTATGA |
NCBI RefSeq | NM_007784 |
Alternative Names | CASA; CSN1 |
Titer | >1*10^10 GC/mL |