shRNA Adeno-associated Virus Serotype 2, pU6-(Defb34-shRNA-Seq1)(CAT#: AAV-SI2345WQ)

This product is a Defb34-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Defb34 gene has antibacterial activity. The expression of Defb34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Defb34-shRNA-Seq1
Related Target/Protein Defb34
Region CDS
TargetSeq GCAGCAGGATTAATGGGAGAT
NCBI RefSeq NM_183035
Alternative Names BD-34
Titer >1*10^10 GC/mL
Target Gene
Gene ID 360211
Uniprot ID Q7TNV8

Related Products