shRNA Adeno-associated Virus Serotype 2, pU6-(Defb34-shRNA-Seq1)(CAT#: AAV-SI2345WQ)
This product is a Defb34-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Defb34 gene has antibacterial activity. The expression of Defb34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Defb34-shRNA-Seq1 |
Related Target/Protein | Defb34 |
Region | CDS |
TargetSeq | GCAGCAGGATTAATGGGAGAT |
NCBI RefSeq | NM_183035 |
Alternative Names | BD-34 |
Titer | >1*10^10 GC/mL |