shRNA Adeno-associated Virus Serotype 2, pU6-(DOLK-shRNA-Seq1)(CAT#: AAV-SI0464WQ)
This product is a DOLK-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | DOLK-shRNA-Seq1 |
| Related Target/Protein | DOLK |
| Region | CDS |
| TargetSeq | GCAGATCATTTCTGTAGCTCT |
| NCBI RefSeq | NM_014908 |
| Alternative Names | DK; DK1; CDG1M; SEC59; TMEM15 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Dolichol kinase deficiency |