shRNA Adeno-associated Virus Serotype 2, pU6-(DZIP1L-shRNA-Seq2)(CAT#: AAV-SI0136WQ)
This product is a DZIP1L-shRNA encoding AAV, which is based on AAV-2 serotype. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | DZIP1L-shRNA-Seq2 |
| Related Target/Protein | DZIP1L |
| Region | CDS |
| TargetSeq | CCAGTGGAAGAGGTGTTAGAA |
| NCBI RefSeq | NM_173543 |
| Alternative Names | PKD5; DZIP2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Testis cancer |