shRNA Adeno-associated Virus Serotype 2, pU6-(ENSMUSG00000063277-shRNA-Seq11)(CAT#: AAV-SI2205WQ)

This product is a ENSMUSG00000063277-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ENSMUSG00000063277-shRNA-Seq11
Related Target/Protein ENSMUSG00000063277
Region CDS
TargetSeq GAAGGAAATGGTTCTGGAGAA
NCBI RefSeq NM_001024713
Alternative Names Gm10128
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100042312
Uniprot ID K7N708

Related Products