shRNA Adeno-associated Virus Serotype 2, pU6-(FAM24B-shRNA-Seq1)(CAT#: AAV-SI1950WQ)

This product is a FAM24B-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of FAM24B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM24B-shRNA-Seq1
Related Target/Protein FAM24B
Region CDS
TargetSeq GCTGTGAAGGATATAGAATGT
NCBI RefSeq NM_152644
Titer >1*10^10 GC/mL
Target Gene
Gene ID 196792
Uniprot ID Q8N5W8

Related Products