shRNA Adeno-associated Virus Serotype 2, pU6-(FAM36A-shRNA-Seq1)(CAT#: AAV-SI0498WQ)
This product is a FAM36A-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FAM36A-shRNA-Seq1 |
| Related Target/Protein | FAM36A |
| Region | CDS |
| TargetSeq | CTTTGGGATGCTGGTTTCATT |
| NCBI RefSeq | NM_198076 |
| Alternative Names | COX20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mitochondrial complex IV deficiency |
