shRNA Adeno-associated Virus Serotype 2, pU6-(FAM53C-shRNA-Seq1)(CAT#: AAV-SI1521WQ)

This product is a FAM53C-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM53C-shRNA-Seq1
Related Target/Protein FAM53C
Region 3UTR
TargetSeq GCAGCCTATGATTGCTTCTTT
NCBI RefSeq NM_016605
Alternative Names C5orf6
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 51307
Uniprot ID Q9NYF3

Related Products