shRNA Adeno-associated Virus Serotype 2, pU6-(KIAA0802-shRNA-Seq3)(CAT#: AAV-SI0183WQ)
This product is a KIAA0802-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KIAA0802-shRNA-Seq3 |
Related Target/Protein | KIAA0802 |
Region | CDS |
TargetSeq | CCAAGTTTGAACGCACATGCT |
NCBI RefSeq | NM_015210 |
Alternative Names | SOGA2; CCDC165; MTCL1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Microtubules (MTs) growth |