shRNA Adeno-associated Virus Serotype 2, pU6-(Ktn1-shRNA-Seq3)(CAT#: AAV-SI1747WQ)
This product is a Ktn1-shRNA encoding AAV, which is based on AAV-2 serotype. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Ktn1-shRNA-Seq3 |
| Related Target/Protein | Ktn1 |
| Region | CDS |
| TargetSeq | CTCATCCCTTCAGTAGTTATT |
| NCBI RefSeq | NM_008477 |
| Alternative Names | CG1; KNT; MU-RMS-40.19 |
| Titer | >1*10^10 GC/mL |