shRNA Adeno-associated Virus Serotype 2, pU6-(LAMP3-shRNA-Seq2)(CAT#: AAV-SI0240WQ)
This product is a LAMP3-shRNA encoding AAV, which is based on AAV-2 serotype. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LAMP3-shRNA-Seq2 |
| Related Target/Protein | LAMP3 |
| Region | CDS |
| TargetSeq | GTCTCAGATCCAGAGACAATT |
| NCBI RefSeq | NM_014398 |
| Alternative Names | LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral squamous cell carcinoma |