shRNA Adeno-associated Virus Serotype 2, pU6-(LOC286238-shRNA-Seq3)(CAT#: AAV-SI0083WQ)

This product is a LOC286238-shRNA encoding AAV, which is based on AAV-2 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LOC286238-shRNA-Seq3
Related Target/Protein LOC286238
Region CDS
TargetSeq GCAGGAAGACAGCAAGGAATA
NCBI RefSeq XM_379684
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease (CVD)

Related Products