shRNA Adeno-associated Virus Serotype 2, pU6-(LOC80154-shRNA-Seq1)(CAT#: AAV-SI0250WQ)

This product is a LOC80154-shRNA encoding AAV, which is based on AAV-2 serotype. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LOC80154-shRNA-Seq1
Related Target/Protein LOC80154
Region CDS
TargetSeq GAGAAGCTGCAGGAAAGTACA
NCBI RefSeq NM_025084
Titer >1*10^10 GC/mL
Related Diseases Laryngeal cancer

Related Products