shRNA Adeno-associated Virus Serotype 2, pU6-(LSM12-shRNA-Seq2)(CAT#: AAV-SI0474WQ)

This product is a LSM12-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LSM12-shRNA-Seq2
Related Target/Protein LSM12
Region 3UTR
TargetSeq GCTCCTCATTGAGGGATAGTT
NCBI RefSeq NM_152344
Alternative Names PNAS-135
Titer >1*10^10 GC/mL
Related Diseases Oxidative Stress
Target Gene
Gene ID 124801
Uniprot ID Q3MHD2

Related Products