shRNA Adeno-associated Virus Serotype 2, pU6-(LSM12-shRNA-Seq2)(CAT#: AAV-SI0474WQ)
This product is a LSM12-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LSM12-shRNA-Seq2 |
Related Target/Protein | LSM12 |
Region | 3UTR |
TargetSeq | GCTCCTCATTGAGGGATAGTT |
NCBI RefSeq | NM_152344 |
Alternative Names | PNAS-135 |
Titer | >1*10^10 GC/mL |
Related Diseases | Oxidative Stress |