shRNA Adeno-associated Virus Serotype 2, pU6-(Lsm14a-shRNA-Seq1)(CAT#: AAV-SI1778WQ)

This product is a Lsm14a-shRNA encoding AAV, which is based on AAV-2 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lsm14a-shRNA-Seq1
Related Target/Protein Lsm14a
Region CDS
TargetSeq CAACATCTCTTGTGATGATAA
NCBI RefSeq NM_025948
Alternative Names RAP55; FAM61A; RAP55A; C19orf13
Titer >1*10^10 GC/mL
Target Gene
Gene ID 26065
Uniprot ID Q8ND56

Related Products