shRNA Adeno-associated Virus Serotype 2, pU6-(Lysmd1-shRNA-Seq1)(CAT#: AAV-SI2285WQ)

This product is a Lysmd1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Lysmd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lysmd1-shRNA-Seq1
Related Target/Protein Lysmd1
Region 3UTR
TargetSeq CCACTTCATATGTATCTGTAA
NCBI RefSeq NM_028134
Alternative Names SB145
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388695
Uniprot ID Q96S90

Related Products