shRNA Adeno-associated Virus Serotype 2, pU6-(Mrpl43-shRNA-Seq1)(CAT#: AAV-SI2222WQ)
This product is a Mrpl43-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Mrpl43 gene help in protein synthesis within the mitochondrion. The expression of Mrpl43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Mrpl43-shRNA-Seq1 |
| Related Target/Protein | Mrpl43 |
| Region | 3UTR |
| TargetSeq | CAGATGAATCTCTGCGTTTAA |
| NCBI RefSeq | NM_053164 |
| Alternative Names | L43mt; MRP-L43; bMRP36a |
| Titer | >1*10^10 GC/mL |
