shRNA Adeno-associated Virus Serotype 2, pU6-(MRPS26-shRNA-Seq2)(CAT#: AAV-SI0401WQ)
This product is a MRPS26-shRNA encoding AAV, which is based on AAV-2 serotype. Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. The expression of MRPS26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MRPS26-shRNA-Seq2 |
| Related Target/Protein | MRPS26 |
| Region | 3UTR |
| TargetSeq | CTGTCACCACTTGGTCAGAAA |
| NCBI RefSeq | NM_030811 |
| Alternative Names | GI008; MRPS13; RPMS13; MRP-S13; MRP-S26; NY-BR-87; C20orf193; dJ534B8.3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |