shRNA Adeno-associated Virus Serotype 2, pU6-(NCRNA00085-shRNA-Seq3)(CAT#: AAV-SI0111WQ)
This product is a NCRNA00085-shRNA encoding AAV, which is based on AAV-2 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | NCRNA00085-shRNA-Seq3 |
Related Target/Protein | NCRNA00085 |
Region | CDS |
TargetSeq | CAAGCTTGAAGAGTGTGAGGA |
NCBI RefSeq | NM_207324 |
Alternative Names | LET7EH; SPACA6P; LINC00085; SPACA6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |