shRNA Adeno-associated Virus Serotype 2, pU6-(Olfr1532-ps1-shRNA-Seq4)(CAT#: AAV-SI2035WQ)
This product is a Olfr1532-ps1-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr1532-ps1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1532-ps1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Olfr1532-ps1-shRNA-Seq4 |
Related Target/Protein | Olfr1532-ps1 |
Region | CDS |
TargetSeq | CTCTTCTATGGCTCAGGAATA |
NCBI RefSeq | NM_001011542 |
Alternative Names | Olfr708; MOR260-6P; MOR260-9P; GA_x6K02T2PBJ9-9297671-9298594 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |
Target Gene | |
---|---|
Gene ID | 258173 |
Uniprot ID | A0A0R4J8U2 |