shRNA Adeno-associated Virus Serotype 2, pU6-(Osgin1-shRNA-Seq1)(CAT#: AAV-SI2303WQ)

This product is a Osgin1-shRNA encoding AAV, which is based on AAV-2 serotype. The Osgin1 gene encodes an oxidative stress response protein that regulates cell death. The expression of Osgin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Osgin1-shRNA-Seq1
Related Target/Protein Osgin1
Region CDS
TargetSeq GACTTGGTCATAGACCCAGAT
NCBI RefSeq NM_027950
Alternative Names BDGI; OKL38
Titer >1*10^10 GC/mL
Related Diseases Inflammatory
Target Gene
Gene ID 29948
Uniprot ID Q9UJX0

Related Products