shRNA Adeno-associated Virus Serotype 2, pU6-(Patl2-shRNA-Seq1)(CAT#: AAV-SI2321WQ)
This product is a Patl2-shRNA encoding AAV, which is based on AAV-2 serotype. The Patl2 gene encodes a RNA-binding protein that acts as a translational repressor. The expression of Patl2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Patl2-shRNA-Seq1 |
| Related Target/Protein | Patl2 |
| Region | CDS |
| TargetSeq | CAGGGTTGAGTTTCTCCAGTT |
| NCBI RefSeq | NM_026251 |
| Alternative Names | OOMD4; Pat1a; hPat1a |
| Titer | >1*10^10 GC/mL |
