shRNA Adeno-associated Virus Serotype 2, pU6-(Poc5-shRNA-Seq1)(CAT#: AAV-SI1889WQ)
This product is a Poc5-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Poc5-shRNA-Seq1 |
| Related Target/Protein | Poc5 |
| Region | CDS |
| TargetSeq | CAACAGCAGTTTGGCGATAAT |
| NCBI RefSeq | NM_026173 |
| Alternative Names | C5orf37 |
| Titer | >1*10^10 GC/mL |