shRNA Adeno-associated Virus Serotype 2, pU6-(RPRM-shRNA-Seq1)(CAT#: AAV-SI0410WQ)

This product is a RPRM-shRNA encoding AAV, which is based on AAV-2 serotype. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert RPRM-shRNA-Seq1
Related Target/Protein RPRM
Region CDS
TargetSeq CATGATCAACTTCCTCGTGAA
NCBI RefSeq NM_019845
Alternative Names REPRIMO
Titer >1*10^10 GC/mL
Related Diseases Lung carcinoma
Target Gene
Gene ID 56475
Uniprot ID Q9NS64

Related Products