shRNA Adeno-associated Virus Serotype 2, pU6-(SESN3-shRNA-Seq2)(CAT#: AAV-SI1714WQ)

This product is a SESN3-shRNA encoding AAV, which is based on AAV-2 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SESN3-shRNA-Seq2
Related Target/Protein SESN3
Region CDS
TargetSeq GCTGAACTTCTTTATGCTCTT
NCBI RefSeq NM_144665
Alternative Names SEST3
Titer >1*10^10 GC/mL
Related Diseases Obesity
Target Gene
Gene ID 143686
Uniprot ID P58005

Related Products