shRNA Adeno-associated Virus Serotype 2, pU6-(SF3A3-shRNA-Seq1)(CAT#: AAV-SI0054WQ)
This product is a SF3A3-shRNA encoding AAV, which is based on AAV-2 serotype. The SF3A3 gene encodes subunit 3 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SF3A3-shRNA-Seq1 |
Related Target/Protein | SF3A3 |
Region | 3UTR |
TargetSeq | CATGTTCTCCAATCCCAGGTA |
NCBI RefSeq | NM_006802 |
Alternative Names | PRP9; PRPF9; SAP61; SF3a60 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung cancer |